Blastocladiella emersonii clone report

Clone ID BeE120N37C08
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N37C08
GTTGCTTCGCTCAACTCATGATGTATTTGTTAAACTCTACCTTGGGGCCT
CCCTGTCGTGGCTCGTTCACATGATGTACCGCTGCTTCCTCAAGTTGCAG
TCCTTGGAGGTCTCGCGCTTGCGCTTGGCGCCGCTACTGTGTACCGCCGA
TCCCGCTGAGGTGGAACATGCGTCCGTAGCCGGCAGGTGGCACGGCTGGA
TCTCGACCACGCTGAAAATGTCCGGTGATGGCTCGCGGCTACGGCCCGCG
TTATCC
    




The gene BeE120N37C08 is related to E120-NOR-37-C08-U.AB1 ():

Sequence ID Image
E120-NOR-37-C08-U.AB1
No Image