Blastocladiella emersonii clone report

Clone ID BeE120N37B07
Best BLASTX Match ref|NP_001011017.1|
Function Description hypothetical protein LOC496426 [Xenopus tropicalis]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N37B07
ATGGACGCTACCAACCCCGCCGCCAACCGCGACGCCATGCACGTCGACGC
GCCCAATGCCGAGCCCGCGCCCAACGCCAGCATGGCGACGCCCATTGAGC
TCCTCCCGGGCGCTTCCTCTGCCGCGGCGCCCGAGCAGGCGCACCCGTTT
GGCGTCGAGATCCGCACCGTTGACGAGATCTTTGAGCAGGAGAAACGCGC
GATCCTCGAGGCCAACAAAGACTTTCTGCAGGGCCTGCCCGTGCGGTCGT
ACCTCGACCAGACGGTCGTCCCGATCCTGCTCGAGGGCATGAAGGCGATT
GTGCGCGAGCGCCCACCAAACCCGTGCGAGTACCTCGGCCTATTCCTGCT
CAAGAACGCGGCACGCGTCGACAAGCCCGCCGCGCCCGCTGCCTCCTCTC
CCTCCTCTGCCGCTGCTGCTGCTGCCGCGGCTGCTGCTACCTCTGCCGCG
CCCGCCAACGGGTCCGCGCCACCGGCCGCGCAGTAACGTCGCGCCATGTG
AACCAACAACCAATGAATTTCGTTATTTCAG
    




The gene BeE120N37B07 is related to E120-NOR-37-B07-U.AB1 ():

Sequence ID Image
E120-NOR-37-B07-U.AB1
No Image