Blastocladiella emersonii clone report

Clone ID BeE120N37B06
Best BLASTX Match gb|AAG45917.1|
Function Description guanylyl cyclase [Heterodera glycines]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N37B06
CGGGTCGCTCACGCAGCGCCAGCACGCGGTCGAGATCACCGAGTGCGCGT
TCCGGTTCCTCAAGGTGGTCGAGGAGCTCGACATGTCGGACCAGGTCCAG
GACTCGGTCCAGATCCGCATCGGCATGCACTCGGGCTCGGCCGTCGGCGG
CGTCGCCGGCATCGTCATGCCCCGCTTCGCCCTGTTCGGCGAGACCCCCA
ACATCGCCGGCCAGATGGAGCAGAAGTCGCAGCCCAACCGCATCCACGTC
TCGCCCGCCACATACGAGCTCATCAAGAAGGACTACGACCTCGACGCCCG
CCCCGAACCCGTCACGCTCGAGGGCGGCAGCAACATGAGCACCTACTGGC
TCAAGGGCAAGAAGGCCGCCGCGACCGCCTCGGCCAAGTCCAACCGCCGC
GCCGGTATGGGCCGCACCACGTCCTCGTCCGCGTCCAGCAACCGCAAGTC
GGTGCGCATGGCCGAGTAACGGACGGGTGTGATCGACGATGGGACGGAAA
CACTAGAATACCTGTTCTTGTTGCAAATGATATAAACGTTTGACTTG
    




The gene BeE120N37B06 is related to E120-NOR-37-B06-U.AB1 ():

Sequence ID Image
E120-NOR-37-B06-U.AB1
No Image