Blastocladiella emersonii clone report

Clone ID BeE120N37A02
Best BLASTX Match gb|AAH75123.1|
Function Description MGC81800 protein [Xenopus laevis]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N37A02
AAGAAGTGGAGCGTCGCACACGCGACTTAACCCGCTGCAACGGACCACCA
ACCACACGAGCACCACACACCACCATGTCGACCGCCATCACCCTCCCCGC
CGATTACGGCTACGTGATCCTCGGTCTCGGCGGCATCATGCTGCAGTACC
AGCTCTCCTCGCGCTTCGTGATCTCGCTGCGCAAGCAGCTCAAGGTCGAG
TACCCGGACATGGGCACCGGCATCTACGCCCAGAAACTGTCCGAAAAGGA
CTGGGTCAAGTTCAACTCGGCCGTCCGCGTCCAGCTCAACTACCTCGAGC
AGCTGCCCAACGTCCTCTTCTCCACCGCCCTCGCGGGGCTGTTCCACCCG
AAGCTCGCCGCGGGACTCGCCGCCGCGTACGTCGTGGGGCGCGAGGTGTA
CATCCACGGGTACGCCAAGGAGAGCCCCAAGGCGCGCGTCCGTGGGATGC
CGATTCTGTTCACGAGTTACGTTGCGTTGTTTGGCGTCGCGATGCACGGC
GCGGCCAAGTCGGTGGGCTTGTTCTGAGGCGACCGGTGTATAAATCAGTG
TCCCTCGCC
    




The gene BeE120N37A02 is related to E120-NOR-37-A02-U.AB1 ():

Sequence ID Image
E120-NOR-37-A02-U.AB1
No Image