Blastocladiella emersonii clone report

Clone ID BeE120N36H09
Best BLASTX Match gb|AAW41138.1|
Function Description cytoplasm protein, putative [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N36H09
GGTGTGGCTGCCCGGGTACACGTGTCCGTGGCTCGAGGAGGGCGTGTACG
CGTTCCCGGACCCGGAGGAGTACGCGGGGCAGCCGCCAGAGGTGCTCAAG
CCCGACTACTTCACGAAACACCCGAGGACCAAGCAAGCCGTCGACTTCAA
CCAGGACTTCTACCTCCCCTTCATTAACATGTACGCTGTGGCGATCCAGC
AGGCGTTCCCGGACGCGCTGATCCTCGCCGAGCCGATCCCGCAGGAGCTG
CCGCCCGTCTTCACCCAGCAGGTGCCCAACCTCGTCTACGCGCCGCACTG
GTACGATCTCAAGTCCGTCTTCTCCAAGGCCTTCGACGGGTTCATCACCC
ACGACGTGCCCGCCCTGCGCGTCTCGCGCAACCTCATCGCCGCCACCTAT
TTCGGCCTCCAGGGCGCCAAGCGCAACTACGCCAACCAGCTCCGCAAGCT
GCACGCCACGGGCAAGGAGCGCGTCGGGAACGTGCCCTGCGTGATCGGCG
AGTGCGGGATCCCGATGGACCTGAACCGGCGCGCGGCCTTCGACACGGGC
AACTACGCGCACCACAACAACTTCCTGGACGCGGTCATCAGCGCCATGGA
GGCCAACCTCCTCCACTTCACGCTGTGGAAACTACACCCGGGCAAA
    




The gene BeE120N36H09 is related to E120-NOR-36-H09-U.AB1 ():

Sequence ID Image
E120-NOR-36-H09-U.AB1
No Image