Blastocladiella emersonii clone report

Clone ID BeE120N36F12
Best BLASTX Match ref|XP_761209.1|
Function Description hypothetical protein UM05062.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N36F12
CGCTGCCCATCGCACGCACGCCTTTGCTTGCCACGTAACTCTGCGCACGC
GCCGCACGCGCACTCCCCCTCGCAACCCGACTGCCCGCCCGCCCGCGCGA
CCGCCACCACGATGCATCTGTTTGGAAGGGGCAAGCCAAAGACGACGCCC
AAGGACGCCATCATCCGGCTGCGCGAGACGCTCGACATGCTCGAGAAGCG
CGAGCGGTACCTGCAGACCAAGATCGACAACGAGCTCAAGACGGCCAAGG
CCAATGCGACCAATAACAAGCGCGCCGCGCTCATGGCGCTCAAGCGCAAG
AAAATGTACGAGACGCAGATCGAGAAGATCTCGGGCGCGCGCATGACCAT
CGAGACGCAGATGGGCACCATCGAGAACGCCAACGTCAACCTCGAGGCCA
TGAAGGCCATGAAGATGGGCGCCGATGCCATGAAGGAGATTCACGGCGCC
ATGGACATCAACAAGGTGGACCAGACCATGGACGAGATCCGCGACCAAAT
GGACCTGGCCAACGAGATCTCGGACGCCATCTCGCAGCCCGTCGGCATGG
GCATGGACATGGACGAGGACGAGCTCAACGCCGAGCTCGAGCTGCTCGAG
CAGGAGGAGCTCGACAGNCAGCTGCTCGGCCTCGAGAACGTGCCCATCTC
GGCACGCCACGTGCCGACGACCGAGCCTGCCGTCGNGCAGNCACCGCGCC
CGACCAAGGGCCANGTCATCGACGAGGACGAGGGAGCNGNACTCCCATGC
TCAAGGCGTCATGCCATGTAGCCCCGCCGCCGCCCACCATCGAGCTGGCC
GNCCTCTTCTGTTCCTATATTCTCTCCTCGCGNCGTCNN
    




The gene BeE120N36F12 is related to E120-NOR-36-F12-U.AB1 ():

Sequence ID Image
E120-NOR-36-F12-U.AB1
No Image