Blastocladiella emersonii clone report

Clone ID BeE120N36B04
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N36B04
GACATGGAAAACCGTTTATGAGGATACGCAACGCGAAAGAAGAACGACAG
AGTGTGGGTAGTGGCCGCGCGCCTCGCTGAGCGCGTCGCCGCCGTCTAGT
GGACGGCCTCGCTAGTCGAGGCTCTGGTACCCGCCCTTGGTCGCCGTCGG
CGCGCCGCCGCCACCGCTGGACCCGGGCGCGGGGAGCGCGACGCTGCTGG
TGCTACCGTGCAGCGTGCCGGACGTGGCGTGGTGGACGGGCACGGCC
    




The gene BeE120N36B04 is related to E120-NOR-36-B04-U.AB1 ():

Sequence ID Image
E120-NOR-36-B04-U.AB1
No Image