Blastocladiella emersonii clone report

Clone ID BeE120N36B02
Best BLASTX Match ref|XP_957904.1|
Function Description hypothetical protein [Neurospora crassa OR74A]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N36B02
CTCGTCTTCGACTGCGCGTGGGACGTGACCACGCCGTTCTTCGAGGCCAT
CGGCCCGCTCGCCGTCCCCGGCGTCCTCCCGCCGTTCGTCTCGCTGCGCA
CGTGTAAGAGCGACGTGTGCGTCGGTTTGACGGCTGAGACCGCCGCCGCG
CTCGAGGGGGTCAAGGACTGGATGGTGTCGGGCAAGCATGCCGTGATTTC
GTTCAAAGAGTAATGTATTTCAGACG
    




The gene BeE120N36B02 is related to E120-NOR-36-B02-U.AB1 ():

Sequence ID Image
E120-NOR-36-B02-U.AB1
No Image