Blastocladiella emersonii clone report

Clone ID BeE120N35H01
Best BLASTX Match gb|AAW47173.1|
Function Description vesicle-mediated transport-related protein, putative [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N35H01
TGAAAACACCATGATCAAGTTCATCCTCGTGCAGAACCGGCAGGGCAAGA
CGCGGCTGGCCAAGTGGTACACGCCGCTGGACGACGCCGACAAGCTGACG
GTCAAGGAGGAGGTGCACAAGCTGACGTCGCAGCGCGACCAAAAGTCGCA
GTCCAACTTTGCCGAGTTCCGCACCGACATGCTGGTGTACCGCCGGTACG
CGGGGCTCTTCTTCTGCATGTGCGTCGACGCCAGCGACAACCTGCTCGGC
TGCCTCGAGTCCATCCACCTGTTCGTCGAGGTCCTCGACACGTTCTTCGG
GAACGTGTGCGAGCTCGACCTCGTCTTCAACTTCTACAAGGTCTACGCCA
TCCTCGACGAGGTGTTTCTCGCCGGCGAGGTCGAGGAGACGGCCAAGCAG
ACGATCCTGCAGCGGCTCGAGCAGCTGGAGAAACTCGACGGCTAGCCCTT
GCTTCCCTCGCTCTCGCACACCCAATATACCTTTCCCCCTTCNN
    




The gene BeE120N35H01 is related to E120-NOR-35-H01-U.AB1 ():

Sequence ID Image
E120-NOR-35-H01-U.AB1
No Image