Blastocladiella emersonii clone report

Clone ID BeE120N35F07
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N35F07
GCTCGCGCTCCGCTCCCCGCGCGACTTGACTGCAACGAAGCAACTCGCCG
ACATCGACGCGGCGTCAGCGCTCATCCGTCGTGATTCGCCCATCGCCCCG
CATTCAGTGATACGCCGCGCATCCGCATCCGCCGCGCCGGATCCCCACCG
CTTCGCCACAGCCGACCTCGTGGCACACACACATCTCGTCGGCCGCTGCC
CCACGCGGTCCCCTCTCCCTCGCATCCGCAGCGCACGAAGCAGCAGGGCA
AATCATCCGCCGCCTGCCCTCGTGGTCGTCGACACGCACGCGCACCCGCG
AGGCCCCACCGCCACATCCGCCCCCGTTCCTCGCTCCTCACAAGCAGCAT
GGACCCGCTCGCGCGCCCGGCCGCCGAGGCCGTCAAGACGCCGCTGCTCA
ACGAGCTCGGCGCACGCTCTCGGTCGCCCTCGCCCGCTGCTCCCGCCAAG
TCCTCATCCTCTCCAACCACCATGGGCGCCCTCCCTACGTCCAACCTCGG
CCCCGGCCTGCCGTCCCCC
    




The gene BeE120N35F07 is related to E120-NOR-35-F07-U.AB1 ():

Sequence ID Image
E120-NOR-35-F07-U.AB1
No Image