Blastocladiella emersonii clone report

Clone ID BeE120N34D07
Best BLASTX Match ref|NP_999680.1|
Function Description axonemal dynein light chain p33 [Strongylocentrotus purpuratus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N34D07
TCTCAACAGCATTCTGCCGCCGCGCGAGTGGGAGGAGACGGGCCAGCTGT
GGATCCAGCGCGTGTCGAGCACACCGGCGACGCGGCTCGACGTCATCAAC
CTGCAAGAGCAGCTCGACCAGATGCTGCAGAAGCGGCAGGCGCGCGAGAC
TGGCATTTGTCCCGTGCGCCGTGAGCTGTACAGCCAATGCTTTGACGAGC
TCATCCGCCAGGTGACGATCAGCTGCCAGGAGCGCGGCCTGCTGCTGCTG
CGAGTGCGCGACGAGATCCGCATGTCAATTGCGGCGTACCAGACGCTGTA
CGAGTCGTCGGTGGCATTCGGGATGCGCAAGGCGCTCATGGCCGAGTGGG
GCAAGGCCGAGATGGAGAACGCCATCAAGTCGCTCGAGGACGAGAAGAAG
GCGCTCGAGACGCAGGTGGCCGAGCTCAAGGCCAAGTGCGAGGCCATCGA
GAAGCGCGAGGCCGAGCGCCGCGCCATGGACGAGCGCAAGCACGCTGAGG
AGATCGCCTTCATGAAGAAGACAAACCTGCAGCTCAAGACGCAGCTCGAG
GGCATCCTGGCGCCACAGAAGAAGTGAGAGCCGCGCGTCCTTGTCTTTTT
ATACGATGCATTCACGACTATTCTTGCTGC
    




The gene BeE120N34D07 is related to E120-NOR-34-D07-U.BIN ():

Sequence ID Image
E120-NOR-34-D07-U.BIN
No Image