Blastocladiella emersonii clone report

Clone ID BeE120N34C11
Best BLASTX Match gb|EAT36375.1|
Function Description phosphoglucomutase [Aedes aegypti]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N34C11
CTCTCATGTTGCGAGAAGTTGTATACCTAGCTAGATGCTTACAGGAACTC
GGCAGGGCGAGCACCCACACCGCCGGCCTTGTGGAACACGAGGCCAGCGA
CCGTGTATGCAAGCTGGTCGCACGCCTCGCGGGTCTCGGCCTCGGCGTAA
ACGCGGACCACGTCCTCGGTACCCGAGGGGCGGACAAAACTGG
    




The gene BeE120N34C11 is related to E120-NOR-34-C11-U.BIN ():

Sequence ID Image
E120-NOR-34-C11-U.BIN
No Image