Blastocladiella emersonii clone report

Clone ID BeE120N33G09
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N33G09
CTTCTTGTCCACCTGCAAAGCTGATCGCAGCAATTTATTACGCTCCTACC
TACCCATTATACTGATCGGATCCAACAACTGAGCCCACGACGACACCATG
CAACGAGCAGCCGGTTCCACCGGCGGCGTGGCAGCGGAAATGGAAACGCC
GGCGAAACGAGGACTCGGAGGCGCTTGACAAGGATCTCAAGTCCACCTCT
GCCGTCGCGGGCTCGGGCGAGAACTCGGGCGATCGGTTCGGCCGCGGGCG
CGAGTTCAAGTACCGCATCGCGCTCGTGGGCTGGCTGGCTCATTTTGCTC
GCGGGCATCGCCATCTCAATGTTCACCATGACGCTGCGGTCAGTTCAGCT
GCAGGAAAACATGGAGCTCATGGTGGCGTCTAACGACCGCCGCTACTACG
TTGACGCTGCGCCTGTACACGCGCGAGTTCATCTCGCCCGACACGACCAT
TTCGACCCTTTCAACGGTGCGCAGCAGCCTCGGTGCCATCCTCGACATCT
TGAACCTGCACAAGCG
    




The gene BeE120N33G09 is related to E120-NOR-33-G09-U.BIN ():

Sequence ID Image
E120-NOR-33-G09-U.BIN
No Image