Blastocladiella emersonii clone report

Clone ID BeE120N33F11
Best BLASTX Match ref|XP_799189.1|
Function Description PREDICTED: similar to Protein KIAA1404, partial [Strongylocentrotus purpuratus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N33F11
GACGGCGTGAGCCCTGAGGCGCTCGAGATCGCGCAGGTGATCCTCGCGAT
CCCCGAGCTCGCGCGTATCGGCCACTGGTACCGCTGCCCGAACGGCCACC
TGTACAGCATCGGCGACTGCGGCATGGCCATGACGCAGAGCCGGTGCCCC
GAGTGCGGCGCGACCATCGGCGGCGGCAGTCACACGCTGCTGTCAAGCAA
CCAGCATGCGTACAGCGTGGTTGACGAGGCGCGCCGCGTCGTGGACCGCG
CGCGCCAGGTCGGTGTGCGAATGGAGTGAGCGCGTGGAGGACGCGCAGAG
TGTGTGTGTGTGACGAGTCGAGAGTTCGCGTGATGAGTTTTTGGTTGAAC
AACATGGATTCTTTTTGTCTTCNNNN
    




The gene BeE120N33F11 is related to E120-NOR-33-F11-U.BIN ():

Sequence ID Image
E120-NOR-33-F11-U.BIN
No Image