Blastocladiella emersonii clone report

Clone ID BeE120N33E08
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N33E08
GGAGCAATCAGTCGGATTTCGTCAAGTCGTTGGTTCTCCCGACAAGGTTC
GCGATCATCGCAAGATTACTCACTCCGAGGTCGTGACGGGCGCCCAGATC
GCGGCTGGCGATGCCATGTGTGCACAAGCTGTTCATGATGTTGCGGAGGG
CCAGGGTAGCATATTTATTGATAATGCTCGCATATCTATGAACGGTGTCC
GCAGACTCAATCGCGCTGTCTCTTTTCCAGGACGTCCGATCGTCAACCTG
ACGCTCTTACAGGTCGATCTTACATTCAGTCTCATCAGCGCCATCAAGTT
TCCTCTTTCGCTTGCGTCACTGGAACTGGTCAGCAACCGTATTGGATACG
GTTGCACGCCAGACGCACTACTCGCGTTCCCCGACTCTCTCCGCTCCCTC
GGAATTTCGTTTGACGACTTGACCCTGCCGCACTTTGCTTCCAGCCTCCG
GCTCCCAACGCGCACTTTGACGAAACTCACGTTCCACACCTGCGTGCTCG
ATTTGGCTAGTGCCACGCACCTTGCGAATGCGCTCCCTGCTTGCCTCAAA
TCCCTCGAGTTCGAATCCTGTGATATTACCGACGACATCATCGCGGTCAT
CTCAATTCGACTTCTAGTCGACCTCGAACGCTTGAACCTTGCCTCAAATG
CGAT
    




The gene BeE120N33E08 is related to E120-NOR-33-E08-U.BIN ():

Sequence ID Image
E120-NOR-33-E08-U.BIN
No Image