Blastocladiella emersonii clone report

Clone ID BeE120N32H10
Best BLASTX Match ref|XP_365727.1|
Function Description hypothetical protein MG02429.4 [Magnaporthe grisea 70-15]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N32H10
CCACGCGTTCGCTCGCGCCGTTGACTTTCCCAACAGCTGAGAGTGAGCGC
GCAACGGCGACGCGGCAAGACGGCGGGCGCGTCACGCCCTTCATGTTCCG
TGTGTACGACGCGCTTATTCAAATCTTGAAGGGCAAGTTTACGACCTACG
GCGAGCTCGCTAGCCATCTCGGCACGTCGCCGCGCGCCGTCGGCCAGGCG
CTTCGAGTCAACCCGTACGCGCCGCACATCCCTTGCCACCGTGTGATCGC
CGCGTCGGGCCAGCTCGGCGGCTTCTTCGGGCAGGCGGGCAACGGCGAGT
ACACGGACAAGAAGCGACGGATGCTCGCGGAGGAGGGCATCGCGATCCCC
GACGCTGGTCTCGATATCGAGCAGCACGCTGCCAGCCTGCATCGGTTCTG
AGCCGGCGATGGCCGAGACATGTCTCCCGATGCCCCGAGACACGCGACCG
CGGCGCAGTACCACATGATACACTTGTGTTTCTCCACGTC
    




The gene BeE120N32H10 is related to E120-NOR-32-H10-U.BIN ():

Sequence ID Image
E120-NOR-32-H10-U.BIN
No Image