Blastocladiella emersonii clone report

Clone ID BeE120N32H02
Best BLASTX Match gb|ABB70410.1|
Function Description hypothetical chitin synthase class V [Puccinia graminis]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N32H02
AAGCCGGGTAACCGCGGCAAGCGCGACTCGCAGATGATCCTCATGCGATT
TATGAACAAGGTGTACCTCGACCAGCCCATGTCGCCCCTCGAGCTCGAGA
TGTACCACCAGATCAACAACGTGATTGGCGTCAACCCCATGTTCTACGAG
CTCTGCCTCATGGTCGACGCTGATACCGAGATCTACAAGGACAGCCTGAC
GCGCCTGGTCGCGACCATGGTCCACGACACGACCGTCATGGGCTGCTGCG
GCGAGACGCGTGTCGCCAACGAGAAGGATACCTGGACGACCATGATCCAG
GTCTACGAGTACTGGATCTCGCACCACATGGCCAAGGCCTTCGAGTCGCT
GTTCGGCACCGTGACCTGTCTTCCCGGTTGCTTCTCCATGTACCGCCTCC
GCACGCCCAACAAGAACACTCCAGTTCTTTGCGCGACGCCGATCATCAAG
GAGTACGGCAACGTCCACGTCGACACGCTGCACATGAAGAACCTGCTCCA
TCTCGGCGAGGACCGCTACCTGACCACGCTCATGCTCAAGTACCATCCCA
ACATGCGCACGGTCTTCACCGCCGATGCGATTTGCGAGACGGTCGCGCCC
GA
    




The gene BeE120N32H02 is related to E120-NOR-32-H02-U.BIN ():

Sequence ID Image
E120-NOR-32-H02-U.BIN
No Image