Blastocladiella emersonii clone report

Clone ID BeE120N32F08
Best BLASTX Match gb|ABA58350.1|
Function Description Peptidase C14, caspase catalytic subunit p20 [Nitrosococcus oceani ATCC 19707]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N32F08
CCACGCGTTCGAAGCTGCTCTGAAAACCCCCCCTCGTTCGACTCAACTAT
GCCAGACGCCGCGCTCTGCCTCGGAATGACCTACAAGGACGGTCTCGGCG
CCACGCCGATCCCGGGCTGCGACATTGACGCGCGCACCATGTCGGACATC
GCGCACGGCATGGGCATCGAGAACGTGCAGACCGTCACCGACACGGACGC
GCCCGTCACGCGCGAGCAGATCCTCGCCGGGCTCCGCGACATGGTCGCGC
AGGCGCAACCGGGCGACACGCTACTCTTCTCGTACGCCGGCCACGGCGGC
CAGAAGGCCAACCCGAACGCCGGCGAGGCCGACGGGCTCAGCGAGTTCCT
CGTCGCCTCGGACGGACCCGTCTACGACTACGAGCTGCGCGAGATCCTGT
CGGGCCTGCCCGAGGGCGCCACCATGACCATGGGCTTCGACTGCTGCCAC
TCGGAGACCATGCTCAACTTCGATATGGGGTCGACCGACGACATTGCCGG
CACCGTCGTCTCCATCTCGGCCGCCCAGG
    




The gene BeE120N32F08 is related to E120-NOR-32-F08-U.BIN ():

Sequence ID Image
E120-NOR-32-F08-U.BIN
No Image