Blastocladiella emersonii clone report

Clone ID BeE120N32E03.2
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N32E03.2
GCAAGCCACCGTGGGGATGGTCTCGGCCACACGACCGCGTGGATACCAGT
CGCGCGTGCATGCCGGGTACTCCACACGAGCGTAAAAGACCGCTGCTGAA
ACTGCGGGGTCGCGAAACTCAAAAGGCAGGAGCAGGAGCTTGCAAGCGAC
CAGTGCCGTCACGGAAACG
    




The gene BeE120N32E03.2 is related to E120-NOR-32-E03-2.BIN ():

Sequence ID Image
E120-NOR-32-E03-2.BIN
No Image