Blastocladiella emersonii clone report

Clone ID BeE120N32A08
Best BLASTX Match ref|XP_748972.1|
Function Description septin B [Aspergillus fumigatus Af293]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N32A08
ACGGCTCGCCCTGTGTCCGCGACGTTATCGACTCCACGCATCCGGGACTG
CCCGCACTGTCACGCATCGACGCCGCCCGACCCGCCCATCGCGACTCTGG
CTGCTGCTCCCCGCGCCGGAACCCATCCGGTACGACCTTCGACCCCTAGA
CGACGCGGCCCGACTCGCGACCCGCCGCCCACGACCTCGCGATCTGATCC
GCTCCTGCACCGTCCTCGAGCCCATACATCCGCCTGCTGCTCGTTATCTC
GCCATGGCAACCAACGGCATCGTCCCCAAACAGCTCAATGGCTTCGTCGG
CTTCTCCAACCTGCCCAACCAGCACCACCGCCGCAGCGTGAAGAAGGGCT
TCCACTTCACCGTCATGGTCGTCGGCGAGAGCGGCCTGGGCAAGTCGACC
CTCGTCAACACCCTCTTCAACACCACCCTCTACCCCGAGAAGCGCGTCCC
CATCACTACCGACCTGCAGAAATCGCTCGACATCCAGCAGATCTCGGCCG
AGATCGAGGAGAATGGCGTGCAGCTGCGCCTCACCGTCATCGACACTCCC
GGCTTCGGCGACTTCATCAACAACGAGGACAGTTGGAAGCCCATCCTGCA
GAACGTCGAGGCACGCTACGACGCCTTCCTCGAGCAGGAGCTGCGCATCA
ACCGCTCCAAGATCGTCGACAACCGCATC
    




The gene BeE120N32A08 is related to E120-NOR-32-A08-U.BIN ():

Sequence ID Image
E120-NOR-32-A08-U.BIN
No Image