Blastocladiella emersonii clone report

Clone ID BeE120N31F01
Best BLASTX Match gb|AAW26915.1|
Function Description unknown [Schistosoma japonicum]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N31F01
TCGACGCTCCACTCGACTGACAGCAACCATGGATCCTGCATTCAACCTCG
ACGCACTCATGCAGCTGTGCGACGCCGTAGACGCGTCGTGCGCGCTCGCC
GAGTTTGAGCACCCAGAACACGCGCAGCTCGTGGCCGCTACCGCTCTGAA
GCTGCCGTCGACGCCGCCGCAACAACGTCCCGCTTCCGCCATAACCGATC
CGCCACCGGCGCCCAAGAAGCCCACCAATACACCCCGCCCACTCGCTGTC
CCACCGATCCCGCGCGCGCGCCTCGCGTCGTCGGGCGACCCGGACACGGC
GGTGCGGTGGGTCCAGCGCCAGCTCGACGCGCTGGGGTACAACCACCTGC
CAGGACCCATCTTCTTCCCGATCAACAAGCGCGCGTCGGGCCGGTCGCTC
GCGGCCGTTGCGAAACGGATCCTCGCAGCCGGGCTGCCGATCAAGTGTCT
CGAGGCCGTCGTCGCCGCCATGTGGCTG
    




The gene BeE120N31F01 is related to E120-NOR-31-F01-U.BIN ():

Sequence ID Image
E120-NOR-31-F01-U.BIN
No Image