Blastocladiella emersonii clone report

Clone ID BeE120N31D04
Best BLASTX Match gb|EAS29172.1|
Function Description hypothetical protein CIMG_07918 [Coccidioides immitis RS]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N31D04
GGCTCGTGGACCTTGCGCTCGAGGTGACGAGCGACCAGGACCACAAGTTT
GACCTCGCCGTCGCCGCGGGCAAGCTCGACGTCGCCTTCGCCATCGCCGC
CGAGGCCGACCAGCCCGCCAAGTGGAAGGTGGTCGCCGACGGCGCCCTCG
CCGCGTGGCGCTTCGACATTGCCGAGGAGTGCCTGCGCCGCGCCGCCGAC
CTCGAGGGGCTCATGCTCCTGTACCTGTCGGCGGGCAACGCCACCGGGCT
CCGCGACGTGGCCACGCAGGCGGTCGCCGCCAACAAGCACAACGTCGCGT
TCGCCGCCCTCACGGCGCTCGGCGACGCGCACGCCGCCATCGACCTGCTC
GTCGACACGGACCGCGTCCCCGAGGCCGCACTCGCCGCACGCACGCTCGC
GCCCGCCAAGGTGCCCGAGGTCACCGCCAAGTGGCGCGCGTCGCTCCCCG
CGCGGCTCGCTGGGACCATCGGCGATATCGAGATCCCCGCCGAGTGGGCG
GT
    




The gene BeE120N31D04 is related to E120-NOR-31-D04-U.BIN ():

Sequence ID Image
E120-NOR-31-D04-U.BIN
No Image