Blastocladiella emersonii clone report

Clone ID BeE120N31C02
Best BLASTX Match ref|XP_784012.1|
Function Description PREDICTED: similar to sperm-associated cation channel 2 isoform 1 [Strongylocentrotus purpuratus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N31C02
CGCTGCTGACGCAGGCGCACGGCGTGTCCAAGGGGTGGGAGCTGACGATC
CGCGAGACGCTCATGGCGCTGGCCGTCAAGTCCGAGGAGACCATGTGGCC
GCGCGACACGCTGTTCCGGTACTTCCAGCTCATGGAGTCGCTGCAGGAGA
ACATGCGCGAGTACCAGGAGCTGCAGATGATGGCCAACGCCGTGTTGATG
GAGCTGCACGACTAGCATATACAGGCAAGTATTTTTCG
    




The gene BeE120N31C02 is related to E120-NOR-31-C02-U.BIN ():

Sequence ID Image
E120-NOR-31-C02-U.BIN
No Image