Blastocladiella emersonii clone report

Clone ID BeE120N30B04
Best BLASTX Match ref|XP_417801.1|
Function Description PREDICTED: similar to hypothetical protein RP4-622L5 [Gallus gallus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N30B04
CGTGCATCCTGTGGGGCTGCACCACGCCGCTGATCCGCCGCGGCGCCCTG
GGCGTGGACGCGGTCGCGCACAAGGGCCGGGTCGCCGAGCTCGCGTGGCT
CGCGACCAGCTGGCGGTATGTGCTTCCGCTCGCCCTCAACCTGTGCGGGT
CGCTTGCGTTCGTGCGCGCGTTGCAGTACGCCGACCTCGCAGTCGTCAGC
CCGCTGACCAACTCGTTGACGCTCGCCATGACGTGGGTGACGGGCTGGCT
GATGGGCGAGAACCTGGGCGATCCGGTGAGCCTCGCCGGCGTCGCCCTCG
TCGGCGCGGGCTCGTACCTGTGCATCACTGCCTCGTAGCGTCGTTGTCTA
TACACGTTGTACATTCTC
    




The gene BeE120N30B04 is related to E120-NOR-30-B04-U.BIN ():

Sequence ID Image
E120-NOR-30-B04-U.BIN
No Image