Blastocladiella emersonii clone report

Clone ID BeE120N30A07
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N30A07
TGACCATCGACCCGCTGAACGTCGCGGCGCTGCAGTCGAACCGCATCGGG
ATCGGCGCCGGGATCGGGATCGGCCTGGGTGTCGGCGCGGGCGTCGCGGC
CATGGCCGAGCGCAGCAGGGCCGCCGCCGCGGGAAGGCATCAGGTCAACC
AGCGCACGTCCATCTCGTCGCTGGCCGCGGCGTTCTTCCGGCGGTCGTCG
GCCTCGGTCATCTCGACGGCGGGGCTCGGGCTCGGGACGGGCACGCACGG
CGGGCTGTAGCGAGAGGAGACTCGGGGTTGGATTTGTGTCTGGTTCTATA
CTATCATGGAGTGTATATGACTTTTT
    




The gene BeE120N30A07 is related to E120-NOR-30-A07-U.BIN ():

Sequence ID Image
E120-NOR-30-A07-U.BIN
No Image