Blastocladiella emersonii clone report

Clone ID BeE120N29D12
Best BLASTX Match ref|XP_961141.1|
Function Description hypothetical protein [Neurospora crassa OR74A]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N29D12
CACGCATCATCATGTTTTCCGAGGAGAACAAGGAGCGCATCGTCCGCCTG
ACCGAGCTGGTCAAGAAGGTCGTCCACGTCGGCTACATCCCCTTCATCCT
GTACATTGGCCTCACGCGCTCCAACCCGCGCCCGTCGCTCCTCCGCCTCA
TCCACCCGTTCGCGTAAGCTGCGCGGGTCCTGTCCAGTTGTGTTCTTTCC
CCTCCGCCCCAAATGTTCTAGTACATCGTCGTATTGTGTTCCAC
    




The gene BeE120N29D12 is related to E120-NOR-29-D12-U.BIN ():

Sequence ID Image
E120-NOR-29-D12-U.BIN
No Image