Blastocladiella emersonii clone report

Clone ID BeE120N29C08
Best BLASTX Match gb|EAR86481.1|
Function Description Protein phosphatase 2C containing protein [Tetrahymena thermophila SB210]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N29C08
CGCGCGGTGCTTGGGCGTGTGCGGCCGGACGGGTCGGTCGAGGCCAAGCC
CTTGTCCAACGACCACACCTGCTCGAACAAGGAGGAGCTCGACCGCGTGT
TGAAAAAGGGCGCCCGCGTCGAGCGGTCTGCGACCGAGGGCGCCGGCGAC
GACGGCCCGCTGCGCCTGTTCAAGGGCTCGATGCCGTACCCGGGCCTGGT
CGTGACGCGCGCGCTCGGCGACACGGCGTCCACGGCGATCGGCGTGCTGT
CGACGCCCGAGCTGACGGACCACGCGCTCGATGTCTCGGGTGGCGGCGGC
GACACGATGCTGATCCTGGCCTCGGACGGCGTGTGGGACGGGCTGCCCGG
GCCGACCGAGGCCATTGGCGTCGTCCAGCGCGTGCTCGCCAAGGCGCCCG
CGAACGGCGGTGTCTCAGGCCGCGTCGCCGAGGTGGCGTCCAAGAAGCTC
ATCAAGGCCGCGCTCGCGGGACTCGACAAGCGGCAGATCGACGATAACGT
GTCGAATGTGTGCGTGCTGCTCACCAAGAACGAGGGCGCCCAGTAGTGCG
TCTGTGGGAGGAGACTGGAACGGNGAAGAGAGTAGTAGTAGTAGTGATTG
CCGGAAATCCAAACGCCAAAACATTTTTTTTTGGCCTTT
    




The gene BeE120N29C08 is related to E120-NOR-29-C08-U.BIN ():

Sequence ID Image
E120-NOR-29-C08-U.BIN
No Image