Blastocladiella emersonii clone report

Clone ID BeE120N28H08
Best BLASTX Match ref|XP_657799.1|
Function Description hypothetical protein AN0195.2 [Aspergillus nidulans FGSC A4]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N28H08
TGCTTGAATCATGAACTCGAATGAAAGCGCCTCGTTGTTCAAGGCGTCGC
GCCGCGTCGTCAGCCCCGCCGACGGCGAACGTGTCAGCGTTGTCGGTGCC
TTCACGTTCAAGTGGTCGACCGCCGAGTTCCCCTCGCTCGAGTTCCTTGA
GTCGATCCGCTCCGAGGGCGATGATCTGGCCGATGCGGCTCTCGCTGCGT
TGCTCCGCCTCCACAAGGCGCTTGAAGCGTGCAAGGGTTCCGATCCACAG
GCAACGCCCGCGGTCGCTTTCGCACCTCACAACATGGCGAGCTTCCTGAT
GCGTGTCGTTGCTGCACTCGATCCTGCTGCCGTCCCCAAGGCCTCGACCG
GAGCCGACGAGAACAACAAGACGGTGCCGCCGCTCAACCTTGGCACCATG
TCTCCCGCTGATCGAGACGCCGTCATGGCTTTCTGGCGCGCCGTCACCAC
CGTCCCGAGCTGGGTCGACTGGGCCTCGGTCGCGCGCGGCCAGTCTCTCT
ACTGGAAGTACTTTATCCTCAACGCCGAGACGCTCAGCTCGTACTCTCTC
CTCGGCGGCTACGCGGCCGATTCGATCAAC
    




The gene BeE120N28H08 is related to E120-NOR-28-H08-U.BIN ():

Sequence ID Image
E120-NOR-28-H08-U.BIN
No Image