Blastocladiella emersonii clone report

Clone ID BeE120N28F07
Best BLASTX Match gb|EAT81532.1|
Function Description predicted protein [Phaeosphaeria nodorum SN15]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N28F07
CGAGCAAGCGCGCCAAGACGGCCAAGGCAAGCAAGGGCAAGGACGGTGAC
GAGGATGATGATGAGGACCTCGACGCGCTCCGCCAGCTGATCCACCGCCG
CCAAAACCAGCGCGAGGCCCAGTTCGGCTCCCTCGTCGACCGGCTCGAGG
CCAAGTACGCGTCGGGCCCGTGCTCGAGCAAGTCCAAGGCCAAGGCCAAG
AAGCCCGCCCCTGCGCACGCGCCGGC
    




The gene BeE120N28F07 is related to E120-NOR-28-F07-U.BIN ():

Sequence ID Image
E120-NOR-28-F07-U.BIN
No Image