Blastocladiella emersonii clone report

Clone ID BeE120N27C01
Best BLASTX Match ref|XP_464595.1|
Function Description putative ABC transporter [Oryza sativa (japonica cultivar-group)]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N27C01
GCAAGGGCAAGACCATCGTGATCACTTCCCATAGTATGGAGGAGGTCGAG
GTTCTCTGCTCCCGCCTCGGGATTATGGCCAAGGGCACCATGCGCTGCAT
CGGCAACCAGCTGCGCCTCAAGGAAAAGTACGGCAGCGGTTTCAAGCTCA
CGTACATCACGCAGCCGCAGCACATGGCCGCGGCGACGGAGCGAGTCCTC
GCGCTGCTTCCTCCCGACGCCAAGATTGCCGACTCGTTTGCCGCTACCAA
GACCATCGAGTTCATGCCCACGCCCGGCTCCATTGCCCGCATCTTCGACA
CGATGCAGAACAAGGCCAAGGAGTGGAACATCGAGGACTGGGGGCTCTCG
CAGACGAGTCTCGAGGAGGTCTTCCTGCGCCTCATCTCGGAGACGGACGC
GGAGGGTACCGCCGAGTAGACGAGCAGGTGCGCGACGCCGCGCGAGATCG
TNTGATTGTCGCGCGTCCCTCTGGCATGGTAATAGAAGCCATGCCGTTTT
TCACCAAANAGAAANGAACAAACAGGAAAAAAAAACCGGCAAGATCCCCT
CAC
    




The gene BeE120N27C01 is related to E120-NOR-27-C01-U.BIN ():

Sequence ID Image
E120-NOR-27-C01-U.BIN
No Image