Blastocladiella emersonii clone report

Clone ID BeE120N26G04
Best BLASTX Match ref|XP_636051.1|
Function Description Ras guanine nucleotide exchange factor [Dictyostelium discoideum AX4]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N26G04
GTACTGGGTCGCCACCGAGGTGTGCACGCAGCCCGAGCTCCCGACGCGGA
TCAAGACGGTGGAGCGCATGATCAAGATCGCCAAGATCTGTCGCCGAGAG
CGCAACTTCAACACGACCGTGGCCATCGTTGCGGGCCTCAACAATTCGGC
GGTCCTGCGCCTCAAACAGACGTGGGAGGGCATTCAGGAAAAGTACCGGC
AGACGTTCCAGGACCTCGAGGACCTTGTCTCGCAGACGCACAACTTCAAG
AACTACCGCCACGCCCTGGACACGATGGCGCACGAGGGTTTCCGTCAGCC
GTTCATCCCCTTCTTTGGATTGTTTGTCAAGGACCTCATGTTCTGGAACG
AGAACCCAAAGCTGACCGAGTCCGGACTCATCAACTTCTCCAAGGTCCAG
TCGATTGCAGGGCTGATCCAGGCCTTTCGCCGGTGGCAGGACCACGAGTA
CGCGCCGTCGCCGGCCACGCTCGCTGCCATGGGCGGCAGCAGCGGCACCG
GAAGCAGCGGGGTCGGCGCGATCCCGGAGCTGGTCGAGCAGTACTGCCGA
AACCTCCGCGCGCT
    




The gene BeE120N26G04 is related to E120-NOR-26-G04-U.BIN ():

Sequence ID Image
E120-NOR-26-G04-U.BIN
No Image