Blastocladiella emersonii clone report

Clone ID BeE120N26E05
Best BLASTX Match gb|AAW27778.1|
Function Description SJCHGC04660 protein [Schistosoma japonicum]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N26E05
GCTAGTCGGCCCTGCAGACCCGGTCACGGCCCTGCGCGAGCTGTCTGGGC
CCTACGATCCGGAGCTCGCCCACGTCCTCCACCCCAACTGTCTGCGCGCC
AAGTTTGGCCGCGACAAGGTCAAGAACGCGGTCCACTGCACCGATCTCAA
GGAGGACGCCGAGCTCGAGGTCCAGTTTTTCTTCCAGATCGTGGGCTAGC
AGAGGTGAGGCGCGCGCTGAACGTCAGCGAGCTCGCCGAAGCCGTCGGTG
GACGCGTCGGTCATCGCGGCACGCACCCCGCCACCCTCCTTTCTCCCCTC
GCTCGCTGGATCCGCTCACTCGGAGCGAATACACTTCCTGCAACGC
    




The gene BeE120N26E05 is related to E120-NOR-26-E05-U.BIN ():

Sequence ID Image
E120-NOR-26-E05-U.BIN
No Image