Blastocladiella emersonii clone report

Clone ID BeE120N26B11
Best BLASTX Match ref|XP_394902.3|
Function Description PREDICTED: similar to CG17119-PA, isoform A [Apis mellifera]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N26B11
GTCAAATGGATCTGTGATCTCGGCCATCATCGGTTGGGCCTACTGCGTCG
CTTGGAGCGTCAGCTTCTACCCGCAGCTCATCCGCAACTATCGCCGAAAG
AGCGTCGAGGGCCTCTCGCTCGACTTTCTCGCCTACAACATCATCGGTTT
CTCGTGCTATGCGACGTACACGCTCAGCTACGCATGGTGGCCGGTGGTGC
AGGACGAGTACAAGCGGCGAAACGACGGCCGCGCGAACCTGGTCGCGCCC
AACGACGTCTTTTTCGCCGCGCACGCATGGGTTCTGACCGTGGCCACGGG
CATCCAGGCGCTGTCGTACCGCGAGCGCACGCACACCATCTCCAAGTTCG
CGCGCGTCGTGATCGCCGTCGTGCTCATCGCGATCACGGTCGTCGTGATC
TGGCGCGTCCAGCGGCCCGCGCAGGGCGTCCTCGACATTATGAACTTCCT
CGGCACCGTCAAGCTGTGCATGTCGCTCATCAAGTACATCCCGCAGATGT
ACAACAACTTCAAGGACAAGTCGACCGAAGGCTGGTCCATTGA
    




The gene BeE120N26B11 is related to E120-NOR-26-B11-U.BIN ():

Sequence ID Image
E120-NOR-26-B11-U.BIN
No Image