Blastocladiella emersonii clone report

Clone ID BeE120N25C08
Best BLASTX Match ref|XP_643196.1|
Function Description glutamine amidotransferase [Dictyostelium discoideum AX4]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N25C08
GACGATGCCCGACGGGTGGATGACGTACTACCGCAACGCCAACGACGGGT
CCAACGAGGGGATCATGGGCGGCGGCGGTAAGTGGCGCGCCGTCCAGTTC
CACCCCGAGGCCGCCGGCGGGCCGTCTGACACGATGCACCTGTTCGACGC
GTTCGACAAGGACGTCCGCGCGTACCACGAGCTGCGCACGGCCGCCAAGG
GCGCCAAGAAGGAGAAGGTGGGGACGTCGGCGTCGGTCCACGACGTGTTC
GCCGGGTACCTCAAGGAGCGCGCGAGTGGGATGACGCTGTCGTCGTCCGC
GTAGTCGTTCGTTGTCCTGTAGTATCATTGAAAATGCAAAAATATTTCCT
CTCCNNNN
    




The gene BeE120N25C08 is related to E120-NOR-25-C08-U.BIN ():

Sequence ID Image
E120-NOR-25-C08-U.BIN
No Image