Blastocladiella emersonii clone report

Clone ID BeE120N25C02
Best BLASTX Match gb|EAL38518.1|
Function Description ENSANGP00000027417 [Anopheles gambiae str. PEST]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N25C02
CGAGGACTCGTACCGCAAGCAGGTCGAGGTGGACTCGCAGCAGTGCATGC
TCGAGATCCTCGACACGGCGGGGACCGAGCAGTTCACGGCGATGCGCGAC
CTGTACATGAAGAACGGGCAGGGGTTCATCCTCGTGTACTCGATCACGTC
GCAGGCCACGTTCAACGACCTCAACGAGCTGCGCGAGCAGATCATGCGCG
TCAAGGACGCGGACAAGGTGCCCATGGTGCTGTGCGGCAACAAGTGCGAC
CTCGAGGACGACCGCGTCGTCAAGAAGGACGCGGGCGCCGGCCTCGCCCA
GCAGTGGGGCTGCTCCTTCTTCGAGACCTCGGCACGAAAGAAGATCAACG
TCGACGAGGTCTTCTACGACCTCGTCAGGCAAATCAACAAGCAGCTACCC
GAGAAGCCCGACAAGAAGAAGAAGAAGTGCGTCATCCTGTAAGGAGTCGC
GCCGTCTCGGGTCTCATACTGCTGCTGCTGCTGCTGCTGCCGT
    




The gene BeE120N25C02 is related to E120-NOR-25-C02-U.BIN ():

Sequence ID Image
E120-NOR-25-C02-U.BIN
No Image