Blastocladiella emersonii clone report

Clone ID BeE120N25B12
Best BLASTX Match gb|AAU45227.1|
Function Description At2g43940 [Arabidopsis thaliana]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N25B12
CGGACCTGGACCCCGCCAAGCCCGCCGTGACCCCGCAGTTTGACGCCCTG
TACGACTACACGTTCCTGTGCGCGCTGCCCCCCAGTATGCGCGACGACTG
GGCCTCGCGCGTCGCCGACATCGTGCGGCCCGGCGGCACCCTCGTCACGC
TCATGTTCCCGCTCGACGACCACGAGGACGGACCGCCGTTCGCCCAGTCG
GTCGACGGGTACCGCGCGCTGTTGGCGGAGAAGTTTGACGAGGTCGAGAT
CGCCGACTGCGAGAGCTTCCCGACGCGCGCGGGCAAGGAGAAGATTGGCG
TGTGGAAGCGCAAGTGAGCTGGCGCGTTTGCGCGAGCGAAAATACAGACG
CGATGCGTTTCAGG
    




The gene BeE120N25B12 is related to E120-NOR-25-B12-U.BIN ():

Sequence ID Image
E120-NOR-25-B12-U.BIN
No Image