Blastocladiella emersonii clone report

Clone ID BeE120N24H03
Best BLASTX Match gb|AAP06054.1|
Function Description similar to NM_018184 hypothetical protein FLJ10702, similar TO ADP- ribosylation factor in Homo sapiens; hypothetical protein FLJ10702, similar TO ADP- ribosylation factor in Homo sapiens [Schistosoma japonicum]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N24H03
CGCACCGCCTCCAGGACTCCAAGCGAGCGGCAAGTCGACGCTCGTGAACG
TGATTGCGTCTGGTGAGTTTACCGAAGACACGATCCCGACGCTCGGGTTC
AACATGCGCAAGGTCACCAAGGGCAAGGTGACCATGAAGCTGTGGGACGT
GGGCGGGCAGCCGCGCTTCCGCAGCATGTGGGAACGATACTGCCGGAACG
TCAACGCCATCGTGTTCGTCGTCGACAGCGCAGACCACACCAAGCTCGAG
GCCGCCAAGCAGGAGCTGCGCGGTTTGCTCGAGCGGCCAACGCTCGCCAA
CGTGCCACTGCTCGTCCTCGGCAATAAGAACGACCTGCCTGGAGCTTTGA
CAGTCGAGGGCGTGATCGACGCGCTGGAGCTCAAAAGCTATTCGCAGCGC
GAGATCGCCTGCTACAGCGTGTCGGCCAAGAACCAGGTCAACATCGACAT
CACGCTGCAGTGGCT
    




The gene BeE120N24H03 is related to E120-NOR-24-H03-U.BIN ():

Sequence ID Image
E120-NOR-24-H03-U.BIN
No Image