Blastocladiella emersonii clone report

Clone ID BeE120N24E05
Best BLASTX Match ref|XP_635149.1|
Function Description hypothetical protein DDBDRAFT_0183828 [Dictyostelium discoideum AX4]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N24E05
CATCTGCGCATCTTCATATATATCTGACCTCTAGTAGTTACATCTATTCC
TCCATTCACGGGCGGCCCTTGCCGTACAACCACCAATTCTCGCCGCGGCG
AATCCATTTGGCCAAGGGGTTGTCGCCCGCCTCGGTGAGCACACGGAACG
TGTGGATGGCGCGGAACCCGTTGCGGTTGGCAAACACCATGTCCGTCATG
ACGCGGTCGCCCACGAAGGCGACCTCGCTGGGCGACTTGATCACGCCCGA
GAAGTGCCGCTTGATGGACGAGCCGCCTGCTGGCTTCTTCTCCTTGTGCC
GGAGTACGGGGACGCCGAGCGACTCCTCGAGTCGTTCCGCCTGCGCTCCG
TTCTTGTCGTCGAGCGTGCCCGCCGAATTCGAGTAGATGGCGACGTTGGA
TCGCCCAAAGACGCGGATACACTCGGCGAACGCCTTCTCGACG
    




The gene BeE120N24E05 is related to E120-NOR-24-E05-U.BIN ():

Sequence ID Image
E120-NOR-24-E05-U.BIN
No Image