Blastocladiella emersonii clone report

Clone ID BeE120N24D05
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N24D05
CATGAACATTAAGAAGCTCTTGCATCATTCTTCGATCGTCGTCGTTGTGA
TAGCGCTCCTTGCGTCGGCAAGCACTACTTTCACGTCGACCGGCCCAGCG
TCCCTCGCGATGGGCGCTCCGCGCTGGCTACGACGATCAAGGCGACGAGC
AAGGCGGGCGTGCGGGTCGCTTCGACTGGCACAACTTGGTCGAAGATGGC
GGTGACATAACCCAGAGCCGCCCAAGAGCGTCTGGGGCTACGATGGCCGC
CCGAGAAACGTGGTCTATGTTGTCGCCCGGTAGTGCTGTCGGATTTTTCT
GCTTAGATGTGCATAATAAATGATGTTCGTGCTTG
    




The gene BeE120N24D05 is related to E120-NOR-24-D05-U.BIN ():

Sequence ID Image
E120-NOR-24-D05-U.BIN
No Image