Blastocladiella emersonii clone report

Clone ID BeE120N24C11
Best BLASTX Match gb|EAQ90571.1|
Function Description hypothetical protein CHGG_02506 [Chaetomium globosum CBS 148.51]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N24C11
GTCCGAGCAGCTCGCGGGCCGCGTCATGGACGTGGACGTCGACGCCGAGC
TCGACGCTACGGTCGCCGCGATCCGCCGCGCACCGTCGAACGAGTCGCCG
TGGGTGTACCTGCGCGGGGTGCTCAACCACCAGAACATGGCCACGGCGCC
CGAACGCGTCATGGACGCGTGCAAGACGCTGGTCGCGGGCAACTGCATGT
CGCCGCACTTGTTCGCGTTCCTCGTCGACGAGTACGCGGCGCTGGGCGAC
CTCGAGGCGGCGCGTTCGACGTGCGAGCACCTCGAGCAGACGGTCGACCG
CACGCGCAAGCGGTACTGGGCGTACCGCCGCGCGCAGCTGGTTCAGTAGC
GGGACGAATGAGCGCTAAGAAGAAAAGTATATCCTGTTTTGATTGACCCA
AACCCA
    




The gene BeE120N24C11 is related to E120-NOR-24-C11-U.BIN ():

Sequence ID Image
E120-NOR-24-C11-U.BIN
No Image