Blastocladiella emersonii clone report

Clone ID BeE120N24C03
Best BLASTX Match ref|XP_757568.1|
Function Description hypothetical protein UM01421.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N24C03
GCTACCTTGCACGTACGGTCCGGAATCCCGGGTCGACCCACGCGTTCGGC
GAGCGCCACCGCTCCTTTACCATCTCGTCCCTGACCGTCCACCGCTTCAT
CATCGCCGCCGTCACCGTCTCGGCGAAAGCCATCTGCGACTCGTACTGCA
CCAACGCCCACTACGCCAAGGTTGGGGGGATCTCGACCCAGGAACTCAAC
ACCCTCGAGCTCGAGTTCCTTTTCCTGATCGACTGGCAGGTCGCGTCGCC
CGCGGCCGTGCTGCAGCAGTACTAAGCCAACCTCGTCCGCCAGTAGCCCG
C
    




The gene BeE120N24C03 is related to E120-NOR-24-C03-U.BIN ():

Sequence ID Image
E120-NOR-24-C03-U.BIN
No Image