Blastocladiella emersonii clone report

Clone ID BeE120N24B03
Best BLASTX Match ref|XP_380890.1|
Function Description hypothetical protein FG00714.1 [Gibberella zeae PH-1]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N24B03
AGCAGGAGGACGCCGAGTTCGTCCTGACCATTGTCTCGATCCCGTTCACG
CTCATGATCCTCATCACCGCTGTCTACGGGCTTCGCCGCGAGTCCAAGCC
TGTGATGGCCTCGTTCGTCGCGGGCCTCGCGTTCGGCATCGCCTACTTTG
TGTTCAAGATCGTGCGCATCTGGACGCTCAACCGCGAGCGTCTCTACGGC
ACGCAGCTGTTCCTGACCTTCTTCGCGGCCCTGTCCATCGTGATGCTGGT
CATGACCTTTGCCAACTCGATCGTGTGCATGCTCAACTTTGGCAAGGGTC
TTAAGAGCCACATCACGACCGCGGCGCCAAGCGTATCACCCGCCAAGGTC
GACAACCCCGTGCGCTCCACGCTGGTGTAGGTCGCTTGCGTGGACCCGCA
CTCGCTCGACGTCCCCCTTTTGCATGTTATTTCCCTCTCTGCTGCTTCGG
TAAACCGTTTGCGAT
    




The gene BeE120N24B03 is related to E120-NOR-24-B03-U.BIN ():

Sequence ID Image
E120-NOR-24-B03-U.BIN
No Image