Blastocladiella emersonii clone report

Clone ID BeE120N23E10
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N23E10
CGGCCATGGCGGCTGGGCGACGGGATCGTGTGGGCGACATGATGGCGGCG
GGCGACACGGCGGCGACATGATGGCGGCGGGCGACACGGCGGACGTGGGA
ACTCGGGCGGCGATTACGGCGACGGTGGGAACACAATCAAATTGGCGCTT
CCACGCACGCGTGCATGATGTGCAAACCGTCGTCGTCGTCGCGGAGTAGT
GGCGGCGCGACCTCATCTCCGACGGACGGTCCGTCGGGCACCGCTCTCGT
GTATCCCGTCTCATCTCCGACCGACCCGACCGCGCCTCCCCCGCACGCGA
TCCCGTCGTCGCTGTTGTCGCACTTCACTTGTTCCGCTCACGTCCCCCGC
ATCCCGCTCTGATCCCTGCCCGTCCCTGGTCTCGTGGCCCATCCCAACTG
GCTTCCCTTTTCTTTTTCCGCATCCTCTCTTTCTGGTTTTCTCAAGTTTC
GCTATAGATTCCCTTTTGCTTGCTGTT
    




The gene BeE120N23E10 is related to E120-NOR-23-E10-U.BIN ():

Sequence ID Image
E120-NOR-23-E10-U.BIN
No Image