Blastocladiella emersonii clone report

Clone ID BeE120N22H02
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N22H02
GAGCGGCGACGGCGATGGCGACGACGACGGGTGAGACGACTGTGCGCCGC
CTCATCACATGATCCGTCGCCACCATGAACGGCGCGCGTGCGTTCGCGCC
CGATGTACAGCTGATTCGGAAAAAATACACACTGGGGAGGCGTCCTCACC
GTC
    




The gene BeE120N22H02 is related to E120-NOR-22-H02-U.BIN ():

Sequence ID Image
E120-NOR-22-H02-U.BIN
No Image