Blastocladiella emersonii clone report

Clone ID BeE120N22F02
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N22F02
GTTCGACGCGTCGGGCGATATCCTCGCGCCCAACGCCGCCAACGTGCCCG
CGCTCAACGCCTTCGTCAAGAAGTGGGGCCTGAACTTCCCGAAGCTTGAC
CTCACCGCCGTCGTCCCTGAGGACGGGTTCCCCGGCCTCACGGCGCCCGT
GTTCATCTTCCACCCGCCGGGCCATCCCGTAGCGAACCGCCGCGACAGGT
CCGCCATCGACCCCGAGTCCGTCAACCTGCACCACGACGCGGGCCCGATC
CTCGTCTACGTCCCGCTGCTCCCCGAGCGGCTCCCCGAGGAGCAGCCCGT
GGACGGCGGCGAGGACGGCGACGATAGCGGGAGCACCGCGGATCTCGGGC
TCGGGGTCCCGACGCTCCGCACGTTCGACGCGGGCGCGGCGCCGTGGTGC
GCGACCACCAACTTCGCGTACACGCCCGAGCAGACGCGGCTGCTCGTGAA
CCACGTCCGCGACAAGGTGATCC
    




The gene BeE120N22F02 is related to E120-NOR-22-F02-U.BIN ():

Sequence ID Image
E120-NOR-22-F02-U.BIN
No Image