Blastocladiella emersonii clone report

Clone ID BeE120N22B08
Best BLASTX Match gb|AAI21200.1|
Function Description DNA polymerase iota [Xenopus tropicalis]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N22B08
TGCAAACGAATGGAACTCTGCGCAACACCGTGTCCAGGCCACGCGCCGTG
GTCTTGTTCGACCTGGACTGCTTCTACGCGCAATGCGAGCACCTGCGAGA
GCCGGAACTGGAGAGTTTGCCGCTCGGGATTCAGCAGAAGCAGATCATCG
TGACGTGCAACTACGAGGCGCGCAAGCATGGCGTCAGGAAGCTGACGCTC
GTGACCGAGGCGCTGCGACGATGCCCGCAGCTCGTCATCCGCAGTGGGGA
AGACCTGACACGCTACCGCCAGTGCTCCGAGAACGTTTACCGTGCGCTGC
GCCAGGTGTTCACGGACGAAGTGGCGCGCGTTGAGCGGCAAGGCCTCG
    




The gene BeE120N22B08 is related to E120-NOR-22-B08-U.BIN ():

Sequence ID Image
E120-NOR-22-B08-U.BIN
No Image