Blastocladiella emersonii clone report

Clone ID BeE120N22B04
Best BLASTX Match gb|AAH77113.1|
Function Description Dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit [Danio rerio]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N22B04
GGACGCGGTACACGGGCAGCGGCGGGGTGCACGGGTGGGACCTGCGGCGC
AAGCTGACGAGCCGCGTGGCTAACTACATTGCGTCGACGCTGCTGCAGCC
GGGCGTGTCGGACCTGACGGGCTCGTTCCGCCTGTACAAGAAGCCGGTGC
TGGCCAAGCTGATCTCGGCCGTCATCTCCAAGGGCTACGTGTTCCAGATG
GAGATGATGGTGCGCGCGCGCCAGTTCGGCTTCTCGATTGGCGAGGTGCC
CATCACCTTCGTCGACCGCGTCTACGGCGAGAGCAAAATGGGCGCCGACG
AGATCGCGCAGTACCTGCTCGGCCTGTTCAAGCTGTTTGCCCTCACCTAA
GCGCCGTGGCGCCGGCCCGCTCGGGACCCTGGTGGCTCCCCTATCCCACG
CTGTGAATTTGACCGTTTTCATGCTG
    




The gene BeE120N22B04 is related to E120-NOR-22-B04-U.BIN ():

Sequence ID Image
E120-NOR-22-B04-U.BIN
No Image