Blastocladiella emersonii clone report

Clone ID BeE120N22B03
Best BLASTX Match ref|NP_001025135.2|
Function Description tubulin tyrosine ligase-like family, member 13 [Homo sapiens]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N22B03
GTTCTGGCCGCGGACGTGGTGTATGCGCACCGAACACCGTGACTTTGTTG
CGCACGCGCAGCGGCGGCCGGGGAAGTGGTTCATTGCAAAACCCGACTCC
AAGTCGCGCGGCATCGGGATTTACCTGCTGTCGGACCCCAACGACTATGA
GCCCGACGGTGAGTTTGATATGGTCGTGCAGCAGTACATTGAGCGGCCGA
TGCTCATCGACGGGTACAAGTTCGACCTGCGCGTGTACGCGCTGATCACA
CACTGCGACCCGCTGCGCGTGTACGTGTACAAGGAGGGGCTGGCGCGGTT
CGCGACCGAGCCGTACGGCACCGGGCCCGACGCGACCAACCGCCACCGCG
TGTGCATGCACCTCACCAACTTTTCCATCAATAAGAAGTCGAGCAAGTTT
GTCGACGGCGGCGCGACGGGTGGGTCCAAACGGACTCTGACGTGGGCGCT
GCAGCACCTCGACTCACTGGGCCACGACGGCTCGGGCGCCGTGTGGGCGA
    




The gene BeE120N22B03 is related to E120-NOR-22-B03-U.BIN ():

Sequence ID Image
E120-NOR-22-B03-U.BIN
No Image