Blastocladiella emersonii clone report

Clone ID BeE120N22A04
Best BLASTX Match gb|AAX95537.1|
Function Description Putative Rhomboid family protein [Oryza sativa (japonica cultivar-group)]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N22A04
CCGACGCAGACTTGACGCAACACGACCAAGCACCATGCCCGGGATCCAGC
TGCCGACCATCGGATGCAACGAGCTGCGCCACTGGCTCGACGTCGTGCCG
CTCGGCACCCGCGCCTACGCGGTCGCCGTCTGGGCCCTATACCTTCTGAC
GCTGCTGACGGGCCACAGCGCGGCCGTGTCGGGCCTGTGCTACAACCCGT
CGTCGCTCTTCTCGCTCGCCGTCTACCGGATCTGGCTCGCGCCGCTCATG
CACGGCGGCTTGCTCCACATTCTGTTCAACACGATCGCGCTCCTGTCGCT
CGGAACGCAGGTCGAGAAGCGCCGCGGCACGCTGACCACGCTGTTTGCCA
TGCTCGTCGTGCTGCCGTTCGTCTCGGCCGTCGCGCACTGGTTCCTTCAC
GGCCTCCTGTACCTGGTCGGCCTGACGGGTCCCGAGTGCGCCGTCGGCGC
GTCGGGTGTGCTCTTTGCCCTCATGGCCGCGTNTGCGCTCGGCCACCACG
AGGCCGAGCCGTCGTCGACGTTCGGGCAGTCGC
    




The gene BeE120N22A04 is related to E120-NOR-22-A04-U.BIN ():

Sequence ID Image
E120-NOR-22-A04-U.BIN
No Image