Blastocladiella emersonii clone report

Clone ID BeE120N21F12
Best BLASTX Match gb|AAW46510.1|
Function Description HDEL sequence binding protein, putative [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N21F12
TCCACGCGTCCGCTCGCAGCAGCACGAACCCCGAGCAACGCACACACCAT
GAATATCTTTCGCCTCGTCGCCGACTTGATGCACCTCGCGTCGTTTGTCA
TCTTGTTGCTCAAGATGCACAAGACGCGCTCGGCTGCCGGCATCTCGTTC
AAGTCGCAGCTGCTGTACCTGATCGTGTTCCTGACGCGGTATCTGGACCT
GTTCTACGCGTTCGTGTCCGTGTACAACTCGGTGATGAAGATCACCTTCA
TTGGGTGCACGGCCTACGTCCTGTACCTCATGAAGACCAAGCTGCGCGCG
ACGTGGGACCCGGCGCTCGACACGTTCAAGGTCGAGTACCTGCTGGGCGG
GTCCGCCGTCATGGCCCTGGTCTTCCACTTCAAGTTCACCCTCTCCGAGC
TGCTCTGGAGCTTCTCGATCTGGCTCGAGGCCGTGGCCATCCTGCCGCAG
CTGTCCCAACGGTCGCGCACGGGCCAAGC
    




The gene BeE120N21F12 is related to E120-NOR-21-F12-U.BIN ():

Sequence ID Image
E120-NOR-21-F12-U.BIN
No Image